Who are the ancestors of the dinosaurs?

DNA was extracted from 80-million-year-old bone fragments found in
strata of the Upper Cretaceous Blackhawk Formation in the roof of an
underground coal mine in eastern Utah.
The authors conclude that the DNA sequence,

cccttctattattcattctcattctattcgttattcttgtactccacacatccaaacaac
aaagcataatattccacccattgagtccattcctatcctgattcttagtccccgaacctt

ttacactcacatg

appears to be from a dinosaur that lived 80 million years ago.
Show us step by step of how to do phylogenetic analysis with cytochrome
b sequences. Use these following species
o Human
o Dog
o Rabbit
o rhinoceros
o dugong
o mouse
o whale
o bovine
o sicklebill
o chicken
o magpie
o frog

step 1
1.connect the Internet to website NCBI:http:www.ncbi.nlm.nih.gov chosses nucleotide that you want and insert keyword


To search and choose sequences
1. Insert name that you interest in Latin form and sequences that we used choose Ref. sequ. that are complete genome only from mitochondrion example we want to search sequence of Human we will search

Human --> “Homo sapiens AND cytochrome b
AND reference sequence”

2.For organism that can not search mitochondrion complete genome especially cytochrome b we want to choose data that mostly perfect by delete reference sequence out from data

Keyword
•Human : Homo sapiens NC_001807
•Dog: Canis lupus familiaris NC_002008
•Rabbit : Bunolagus monticularis AY292718
Pentalagus furnessi AY292720
Oryctolagus cuniculus NC_001913
•Rhinoceros :Rhinoceros unicornis NC_001779
•Dugong : Dugong dugon NC_003314
•Mouse :Mus musculus NC_005089
•Bovine :Bubalus bubalis NC_006295
Bos indicus NC_005971
•Frog : Polypedates megacephalus NC_006408
Rana nigromaculata NC_002805
•Chicken: Gallus gallus NC_001323
•Whale : Eschrichtius robustus NC_005270
•Sicklebill :Epimachus albertisi U15205
•Magpie :Cyanopica cyanus pallescens AY701179


2. Search NCBI for cytochrome b nucleotide sequence of 12 different
species


3. Click choose Display > GenBank----> Text and copy in Notepad program
Click Display > FASTA format for NCBI result data in FASTA format and copy in Notepad for use to rearrange nucleotide base.


Step 2

Install program BioEdit

1. Connect Internet to website http://www.google.com/


2. download program by click BioEdit.zip (Full install )


3. Program already install in drive C we will call by Manu Start ----> program ---> BioEdit --> BioEdit

Step 3

To used program BioEdit
1. Manual alignment of sequences will result as the picture



2. Click File ---> New Alignment ---> Import



3. Open FASTA file that collect in Notepad program

3.1 When go in Import --------> sequence alingment file
-Dinosour - Mouse
-Dog - Dugong
-Rabit 1 - Frog 1
-Rabit 2 - Frog 2
-Rabit 3 - Chicken
-Magpie - Gray whale
-Sicklebil - Bovine 1
-Rhinoceres - Bovine 2
-Human

3.2 Will result sequence as picture



4.And then click Accessory Application-->
ClustalW Multiple alignment ---> Run ClustalW


5. Wait for program Run

6.And then we will recieve Alignment ---->save text ---->Accessory
Application and go to DNAmk DNA Maximum likelihood
program with molecular clock



7.We will recieves Data as a picture and then save as text file


8.Open Tree view program and open file that we save as previous



9.program will work and result will show in graphic form of phylogenetic tree

Haploview

find out
1. What is the name of haploview format to use in this analysis?

2. Show the marker and individual quality control of the genotype data use in the analysis?

3. Show the LD map then explain what do you get from the LD map?

4. How many haplotype blocks in this region of Chromosome X, then explain how to interpret them?

5. Find out the tagging SNP in each haplotype block, then explain what the tagging SNPs?

Open Haploview 4.0 program that we can download that program from
http://www.broad.mit.edu/mpg/haploview/download.php But this program must required
java program to manage with this program

1. Download Haploview 4.0 from
http://www.broad.mit.edu/mpg/haploview/download.php


2. Click download from Haploview menu


3.If your computer is window program click HapInstall.exe

4.Click save file


5. Click run

6. Click next


7.Click next


8.Click next


9.Click Finish and program will install on your computer.


10. pepare data that used in Data of Hapmap format.

• Copy data and open in Microsoft Word

• Save data in form Plain text

11. When open Haploview program we will found Welcome to HaploView

• The picture show the window when we open Haploview program

• In Welcome to HaploView window select HapMap Download

Set up

• Release 21

• Select Chromosome that we want to study that in this study is Chromosome X

• Select population group that we want to study in this study select CHB+JPT. And then click OK to start work

• Click HapMap Format for download File and click OK

• Change HW p-value cut off to 0.05 and click Rescore Markers

• And then click Haplotypes the result show as picture

• 

• Show result window in LD Plot

How many haplotype blocks in this region of Chromosome X?
In LD plot the result show

from the result have 3 haplotype blocks are
- Block 1 position 8, 9
- Block 2 position 13, 14, 15, 16, 17
- Block 3 position 24, 25, 26, 27, 28, 29

V. Could you find out the tagging SNP in each haplotype block?
After recieve the result from window Haplotypes for present tagging SNP in each
haplotype block select Display click ''Show tags in blocks'' will present as picture

• present Haplotype block window that present tagging SNP

•Result present tagging SNP are
Block 1 have tagging SNP in position 8,9
Block 2 have tagging SNP in position 13,15
Block 3 have tagging SNP in position 24,27

Example of Taverna Workflow

Example of Taverna Workflow

Taverna diagram

1.Open the new workflow from taverna program


2.Next step insert FASTA you will get nucleotide FASTA sequence


3.Then insert workflow input&output
input insert name sequence
output insret name output


4. Next step make connection



5. Then run workflow



6. Next step insert id of nucleotide sequence that you interest




7. Then run workflow



8. We will got FASTA sequence from workflow

Introduction to Tarvana Workflows

What is a Workflow?

Workflows provide a general technique for describing and enacting a process Describes what you want to do, not how you want to do it Simple language specifies how bioinformatics processes fit together Processes are represented as web services

What is Taverna?

Taverna enables the interoperation between databases A workbench for chaining services together, replicating dataflow, in the and tools by providing a toolkit for composing, executing and managing workflow experiments form of workflows.

Workbench

Run workflow

Double click on file “runme.bat”

Tavana loading

Panes of Taverna

Workbench

Workbench Layout

AME-Advance Model Explorer (bottom left panel) The Advanced Model Explorer (AME- left panel) is the primary editing component within Taverna. Through it you can load.Save and edit any property of a workflow.

Enables

Building

Loading

Editing

Saving workflows

Workflow Diagram Window

Visual representation of workflow

(right hand side)

Shows inputs/outputs,services and control flows

Enable saving of workflow diagrams for publishing and sharing

Avalable Services Panel

Lists services available by default in Tarvana-top left

3000 services

Local java services

Simple web services

Legacy command-line application

Gowlab services

Biomart database services

Biomoby services

Allows theuser to add new services or workflows from the web or from file systems